Jul 19, 2018

Public workspaceBarmah Forest virus TaqMan 2017 (BFV-TM2017) V.3

DOI
dx.doi.org/10.17504/protocols.io.rswd6fe
  • 1Public Health Virology, Forensic and Scientific Services
  • Public Health Virology, Forensic and Scientific Services
Ian M Mackay
Icon indicating open access to content
QR code linking to this content
DOI: dx.doi.org/10.17504/protocols.io.rswd6fe
Protocol Citation: Ian M Mackay, Ina Smith, Judy A Northill 2018. Barmah Forest virus TaqMan 2017 (BFV-TM2017). protocols.io https://dx.doi.org/10.17504/protocols.io.rswd6fe
Manuscript citation:
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: July 19, 2018
Last Modified: July 19, 2018
Protocol Integer ID: 13878
Abstract
The protocol aims explicitly to amplify BFV viruses and not other viruses. The assay targets the E2 gene region and is designed as a qualitative test for investigating BFV infection of humans and arthropods.
Materials
MATERIALS
ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088
STEP MATERIALS
ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088
ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088
Protocol materials
ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088
ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088
ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088
ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088
Before start
If using a different brand or model of real-time thermocycler, check the concentration of ROX is adequate. Method assumes the user is familiar with the thermocycler and software used to run the protocol and with PCR in general.
Oligonucleotide sequences
Oligonucleotide sequences
NameSequence 5'-3'
BFV-FAGTGTGGCAGTACAACTCCCAAT
BFV-RAAGGCACATGGATCTTTCCTTTC
BFV-FAMFAM - CGTGCCCAGGTCCGAAGTTACGG- BHQ
Reagents
Reagents
ReagentSuperScript™ III Platinum™ One-Step qRT-PCR KitLife TechnologiesCatalog #11732088
Reaction set-up
Reaction set-up
The assay has been used on both a Rotor-Gene 6000 and a Rotor-Gene Q real-time thermocycler
Prepare sufficient mix for the number of reactions.
Include a suitable 'dead volume' as necessary if using a robotic dispenser.
ReagentVolume (µl) x1Final reaction concentration
Nuclease-free water4.47N/A
BFV-F 200pmol/µl0.03300nM
BFV-R 200pmol/µl0.03300nM
BFV-FAM 100pmol/µl0.03150nM
2X Reaction Mix1101X
SuperScript® III/Platinum® Taq Mix10.41X
ROX Reference Dye (25µM)0.040.05µM
Template5N/A
TOTAL20 
1SuperscriptTMIII PlatinumTM One-step qRT-PCR kit
  • Dispense 15µL to each reaction well.
  • Add 5µL of template (extracted RNA, controls or NTC [nuclease-free water] ).
  • Total reaction volume is 20µL
Amplification
Amplification
50°C5min1X
95°C2min1X
   
95°C3sec|40X
60°C30sec1|
1Fluorescence acquisition step
Result Analylsis
Result Analylsis
The definition used for a satisfactory positive result from a real-time fluorogenic PCR should include each of the following: A sigmoidal curve – the trace travels horizontally, curves upward, continues in an exponential rise and followed by a curve towards a horizontal plateau phase A suitable level of fluorescence intensity as measured in comparison to a positive control (y-axis) A defined threshold (CT) value which the fluorescent curve has clearly exceeded (Fig.1 arrow), which sits early in the log-linear phase and is <40 cycles A flat or non-sigmoidal curve or a curve that crosses the threshold with a CT >40 cycles is considered a negative result. NTCs should not produce a curve
Figure 1. Examples of satisfactory sigmoidal amplification curve shape when considering an assay’s fluorescent signal output. The crossing point or threshold cycle (CT) is indicated (yellow arrow); it is the value at which fluorescence levels surpass a predefined (usually set during validation, or arbitrary) threshold level as shown in this normalized linear scale depiction. LP-log-linear phase of signal generated during the exponential part of the PCR amplification; TP-a slowing of the amplification and accompanying fluorescence signal marks the transition phase; PP-the plateau phase is reached when there is little or no increase in fluorescent signal despite continued cycling.