Feb 23, 2024

Public workspaceBarcoded and targeted cDNA library preparation for Oxford Nanopore Technologies sequencing

DOI
dx.doi.org/10.17504/protocols.io.kqdg3xzwzg25/v1
  • 1Department of Clinical and Biomedical Sciences, University of Exeter
Rosemary A Bamford
Open access
DOI: dx.doi.org/10.17504/protocols.io.kqdg3xzwzg25/v1
Protocol Citation: Rosemary A Bamford, Szi Kay Leung, Aaron Jeffries, Jonathan Mill 2024. Barcoded and targeted cDNA library preparation for Oxford Nanopore Technologies sequencing. protocols.io https://dx.doi.org/10.17504/protocols.io.kqdg3xzwzg25/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: February 07, 2024
Last Modified: February 23, 2024
Protocol Integer ID: 94844
Funders Acknowledgement:
MRC Research Grant
Grant ID: MR/R005176/1
MRC Clinical Research Infrastructure Grant
Grant ID: MR/M008924/1
Simons Foundation for Autism Research (SFARI)
Grant ID: 809383
Simons Foundation for Autism Research (SFARI)
Grant ID: 573312
Abstract
The NEBNext Single Cell/Low Input cDNA Synthesis & Amplification Module (NEB) was adapted for the purpose of adding Oxford Nanopore Technologies (ONT) compatible barcodes during reverse transcription of RNA. This is a useful process for multiplexing low input samples for ONT transcriptome library preparation.
An optional step before ONT library preparation is the targeted enrichment of cDNA molecules using IDT hybridisation probes. Here we provide a protocol for this process based on the 'PacBio cDNA capture using IDT xGen Lockdown Probes' protocol.
Using this approach, up to 100 samples can be barcoded with individual ONT barcodes via reverse transcription. Samples can then be pooled together and a cDNA PCR amplification performed. This allows sufficient material for cDNA enrichment and/or ONT ligation sequencing library preparation.

Materials
NEBNext Single Cell/Low Input RNA Library Prep Kit for Illumina (E6420S)
Nuclease-free water
dNTPs (NEB, N0447)
TSO-ONT primer (IDT, 100 uM)
ProNex beads (Promega, NG2001)
0.2 ml PCR tubes (low bind)
PCR primers including blockers (IDT, bespoke) - detail including sequences included in protocol
xGen Lockdown hybridisation + wash kit (IDT, 1080577)
xGen Lockdown panels/probes (IDT, bespoke)
Takara LA Taq DNA polymerase hot start (Takara, RR042A)
Ampure XP beads (Fisher Scientific, 10136224)
ONT ligation library kit (Oxford Nanopore Technologies, SQK-LSK114)
HS D5000 screentape (Agilent, 5067-5592)
Qubit dsDNA HS kit (Fisher Scientific, 10616763)
Before start
Order the bespoke IDT primers and dilute to the correct concentration.
Bespoke barcoding of cDNA
Bespoke barcoding of cDNA
This protocol is adapted from that provided with NEBNext Single Cell/Low Input cDNA Synthesis & Amplification Module (NEB, E6420S). Input and component values have been modified from the original kit protocol.
Primer annealing for first strand synthesis
Prepare in a PCR tube on ice. A reaction mix of up to Amount7 µL of total RNA (Amount75 ng ) is added to Amount1 µL Concentration2 millimolar (mM) TSO-ONT primer, Amount1 µL Concentration10 millimolar (mM) dNTPs (NEB) and made up to Amount9 µL with nuclease-free H2O. Gently invert a few times and spin briefly.
Note
Pipetting and flicking the tube may shear RNA/cDNA so try to avoid this for long read sequencing. Gently invert the tube(s) instead and then briefly spin down.


Note
The TSO-ONT primers follow this pattern (TSO primer sequence-ONT barcode sequence-oligo(dT)30). The sequences of ONT barcodes are available from the ONT community. Primers can be ordered from Integrated DNA Technologies (IDT) (idtdna.com). Here is an example containing ONT barcode 01:
5' AAGCAGTGGTATCAACGCAGAGTAC-AAGAAAGTTGTCGGTGTCTTTGTG-TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN 3'

Incubate the mixture in a thermocycler for Duration00:05:00 at Temperature70 °C with the heated lid at Temperature105 °C , then snap cool on ice for Duration00:01:00 .

6m
Reverse Transcription (RT) and Template Switching
Meanwhile, prepare the reverse transcription mix which consists of Amount2.5 µL NEBNext Single Cell RT buffer (lilac); Amount0.5 µL NEBNext Template Switching Oligo (lilac); Amount1 µL NEBNext Single Cell RT enzyme mix (lilac) and Amount1.5 µL nuclease-free water. Mix by gentle inversion and spin briefly. Add Amount5.5 µL of reverse transcription mix to each sample. Gently invert a few times and spin briefly.

Note
Briefly vortex the NEBNext Single Cell RT buffer prior to use

Place the mix in a thermocycler (heated lid at Temperature105 °C ):
Temperature42 °C for Duration01:30:00
Temperature70 °C for Duration00:10:00
hold at Temperature4 °C .

Note
Safe stopping point: samples can be stored overnight at Temperature4 °C or Temperature-20 °C


1h 40m
cDNA amplification by PCR
Prepare the cDNA amplification mix which consists of Amount25 µL NEBNext Single Cell cDNA PCR Master Mix (orange); Amount1 µL NEBNext Single Cell cDNA PCR Primer (orange); Amount0.25 µL NEBNext Cell Lysis Buffer (10X) (white) and Amount13.75 µL nuclease-free water. Mix by gentle inversion and spin briefly. Add Amount40 µL of cDNA amplification mix to each sample. Gently invert a few times and spin briefly.

PCR cycling conditions:
Heated lid set to Temperature105 °C
Initial denaturation:
Temperature98 °C for Duration00:00:45

For 14 cycles:
Temperature98 °C for Duration00:00:10
Temperature65 °C for Duration00:12:30 ,
Temperature72 °C for Duration00:03:00 ,

Final extension:
Temperature72 °C for Duration00:05:00
hold at Temperature4 °C

Note
The number of cycles and extension time have been increased to prioritise the amplification of longer cDNA fragments. This can be optimised for your own samples.

Note
Safe stopping point: samples can be stored overnight at Temperature4 °C or Temperature-20 °C

21m 25s
Cleanup of Amplified cDNA
Bring Promega Pronex beads to TemperatureRoom temperature for Duration00:30:00 prior to use.
Spin tubes down briefly. 0.85X Promega Pronex beads are added. Gently invert a few times and spin briefly. Incubate at TemperatureRoom temperature on Hula mixer for Duration00:05:00 . Briefly spin tubes and place on magnet. Leave beads to settle for Duration00:05:00 . Perform 2x 80% EtOH washes. Amplified cDNA is eluted in Amount27 µL 1X TE.

Note
Eluted cDNA can then be equimolar pooled for ONT library preparation directly or taken forward for enrichment.

40m
Dilute sample 1:5 and run an Agilent HS D5000 screentape

Expected result
A broad peak centred around typical transcript size of 1.5-2 kB.

Total RNA is used to synthesise cDNA and amplified using 14 cycles.

cDNA enrichment
cDNA enrichment
We performed an adapted version of the 'PacBio cDNA Capture Using IDT xGen Lockdown Probes' protocol (Other Documentation - PacBio) and xGen Lockdown Panel.

Note
We used the xGen Custom Hyb Panel Design Tool (https://eu.idtdna.com/pages/tools/xgen-hyb-panel-design-tool) to design 120-mer hybridisation probes against genes of interest. One probe was designed per exon unless the exon was > 1 kB when an extra probe was included.

Barcoded cDNA is equimolar pooled for a total of Amount1 µg cDNA per capture reaction. Prepare in a Amount0.2 mL PCR tube.
Note
The PCR tube needs to have a hole in the cap (use an 18-20 gauge or smaller needle).


Amount1 µL of TSO blocker and Amount1 µL of polyT blocker (poly(dT)30) oligonucleotides (both at Concentration1 millimolar (mM) ) were added to the pooled cDNA.

Note
TSO blocker oligo: 5' AAGCAGTGGTATCAACGCAGAGTAC 3'
PolyT blocker oligo: 5' TTTTTTTTTTTTTTTTTTTTTTTTTTTTTT/3InvdT 3'

Dry the mixture using a DNA vacuum concentrator (set temperature to Temperature45 °C ). Do not overdry.

Add IDT 2X hybridisation buffer (Amount8.5 µL ), hybridisation buffer enhancer (Amount2.7 µL ) and nuclease free water (Amount1.8 µL ) to the dried-down sample. Replace the lid (do not cover the hole with tape). Mix the reaction by gently tapping the tube, followed by a quick spin.
Note
If you plan to add more than one probe panel then do not add the nuclease free water at this stage.

Place the mixture on a Temperature95 °C thermocycler for Duration00:10:00 to denature the cDNA.

10m
After allowing the mixture to cool briefly for Duration00:02:00 at TemperatureRoom temperature . Amount4 µL of xGen Lockdown Panel is added for a total volume of Amount17 µL . Probes should never be added while at Temperature95 °C .
Note
Thaw panels at TemperatureRoom temperature .

If you are adding more than one panel then add Amount3 µL of each panel.


2m
After Duration00:05:00 at TemperatureRoom temperature , briefly spin the tubes and incubate in a thermocycler at Temperature65 °C overnight (lid temperature Temperature100 °C ).

5m
Prepare the wash buffers and Dynabeads M-270 Streptavidin beads provided in the xGen Lockdown Hybridisation and Wash kit and use as per instructions below. The xGen Lockdown Hybridisation and Wash kit is optimal for 3 months at Temperature-20 °C and poor yields may occur if the kit has expired.


Prepare wash buffers
Buffer StockStock Conc.Vol. BufferVol. WaterTotal VolumeFinal Conc.
Wash buffer I10X40 µL360 µL400 µL1X
Wash buffer II10X20 µL180 µL200 µL1X
Wash buffer III10X20 µL180 µL200 µL1X
Stringent wash buffer10X50 µL450 µL500 µL1X
Bead wash buffer2X250 µL250 µL500 µL1X
These volumes are for a single sample - scale up for multiple samples.

Preheat the following wash buffers to Temperature65 °C in a heat block or water bath for at least Duration00:15:00 :
Amount200 µL of 1X wash buffer I
Amount400 µL of 1X stringent wash buffer

Other reagents can be kept at TemperatureRoom temperature

15m
Prepare the capture beads
  1. Allow the Dynabeads M-270 Streptavidin to warm to room temperature for Duration00:30:00 prior to use.
  2. Mix the beads thoroughly by vortexing for Duration00:00:15
  3. For a single sample, aliquot Amount100 µL beads into a Amount1.5 mL LoBind tube. Scale up volume for multiple samples.
  4. Place the LoBind tube in a magnetic rack. When the supernatant is clear, remove and discard the supernatant being careful not to disturb the beads. Any remaining traces of liquid will be removed with subsequent wash steps. Give it Duration00:05:00 to settle. The Dynabeads are "filmy" and slow to collect to the side of the tube.
  5. While the LoBind tube is in the magnetic rack, add Amount200 µL of 1X bead wash buffer. For multiple samples, wash with Amount200 µL x X samples.
  6. Remove the tube from the magnetic rack and vortex until the beads are in solution.
  7. Quickly spin and place the LoBind tube back in the magnetic rack to collect the beads to the side of the tube. Once clear, remove and discard the liquid.
  8. Repeat steps 5-7 for a total of two washes.
  9. Resuspend by vortexing the beads in Amount100 µL of 1X bead wash buffer. For multiple samples, scale up accordingly.
  10. Place the tube in the magnetic rack to collect beads to the side of the tube. Once clear, remove and discard the supernatant.
  11. The washed beads are now ready to bind the captured DNA. Proceed immediately to the next step. Do not allow the capture beads to dry. Small amounts of residual bead wash buffer will not interfere with binding of DNA to the capture beads.

35m 15s
Bind cDNA to the capture beads
Transfer the Amount17 µL hybridised probe/sample mixture to the washed capture beads.
Mix by tapping the tube until the sample is homogenous.
Incubate in a heat block set to Temperature65 °C for Duration00:45:00 or transfer the mix to a PCR tube and incubate in a thermocycler (heated lid set to Temperature75 °C ). Hand mix periodically by gently tapping the tube to keep the beads in suspension, every Duration00:10:00 .

55m
Wash the captured cDNA
  1. The 1X wash buffer I and 1X stringent wash buffer should have been pre-heated to Temperature65 °C .
  2. After the above incubation, remove the tube from the heat block and add Amount100 µL pre-heated 1X wash buffer I.
  3. Mix thoroughly by tapping the tube until the sample is homogenous.
  4. If using a PCR tube, transfer the sample to a Amount1.5 mL LoBind tube (careful of bubbles).
  5. Place the tube in a magnetic rack to collect the beads to the side of the tube. Remove and discard the liquid once clear.
  6. Remove the tube from the magnetic rack and add Amount200 µL of 1X stringent wash buffer heated to Temperature65 °C . Mix by tapping the tube until the sample is homogenous. Work quickly so that the temperature does not drop.
  7. Incubate at Temperature65 °C for Duration00:05:00 .
  8. Repeat steps 5-7 for a total of two washes using 1X stringent wash buffer heated to Temperature65 °C .
  9. Place the tubes in the magnetic rack to collect the beads to the side of the tube. Remove and discard the liquid once clear.
  10. Add Amount200 µL of TemperatureRoom temperature 1X wash buffer I. Hand mix by gently tapping the tube, followed by a quick spin.
  11. Place the tube in the magnetic rack to collect the beads to the side of the tube. Remove and discard the liquid once clear. It will clear quickly but allow Duration00:01:00 .
  12. Add Amount200 µL of TemperatureRoom temperature 1X wash buffer II. Hand mix by gently tapping the tube, followed by a quick spin.
  13. Place the tube in the magnetic rack to collect the beads to the side of the tube. Remove and discard the liquid once clear. Allow Duration00:05:00 .
  14. Add Amount200 µL of TemperatureRoom temperature 1X wash buffer III. Hand mix by gently tapping the tube. Quick spin.
  15. Place the tube in the magnetic rack to collect the beads to the side of the tube. Remove and discard the liquid once clear. Allow Duration00:05:00 .
  16. Remove the tubes from the magnetic rack and add Amount50 µL of 1x TE.
  17. Store the beads plus captured samples at Temperature-20 °C or proceed to the next step. It is not necessary to separate the beads from the eluted DNA.

16m
Amplification of captured DNA sample

ComponentVolume
Water104.5 µL
10x LA PCR buffer20 µL
2.5 mM dNTPs16 µL
12 uM TSO amp primer8.3 µL
Takara LA Taq DNA polymerase1.2 µL
Captured library50 µL
Total200 µL
PCR reaction mix

Note
TSO amp primer: 5' AAGCAGTGGTATCAACGCAGAGT 3'


Split the PCR mix into two tubes, Amount100 µL each.

Amplify using the following PCR protocol:
StepTemperatureTime
195 °C2 mins
295 °C20 s
368 °C10 mins
4Repeat steps 2-3 for a total of 11 cycles
572 °C10 mins
64 °Chold
After amplification, pool the Amount100 µL reactions.

Post amplification clean up
Bring AMPure beads to TemperatureRoom temperature for Duration00:30:00 prior to use.
Spin tubes down briefly. 1X AMPure beads are added. Gently invert a few times and spin briefly. Incubate at TemperatureRoom temperature for Duration00:10:00 . Briefly spin tubes and place on magnet. Leave beads to settle for Duration00:05:00 . Perform 2x 80% EtOH washes. Amplified cDNA is eluted in Amount27 µL 1X TE.

45m
Quantification was determined using the Qubit DNA High sensitivity assay (Invitrogen, UK) (1:5 dilution) and HS D5000 screentape (Agilent, UK) (1:5 dilution).

Expected result
A broad peak centred around typical transcript size of 1.5-2 kB and a concentration of between 3-15 ng/uL. Lengths may vary depending on the lengths of targeted fragments.

Enriched cDNA amplified using 11 cycles.

Library preparation and sequencing
Library preparation and sequencing
Library preparation was performed using ONT’s ligation kit (SQK-LSK114). Follow supplier protocol, which also includes details for sequencing. Recommended library input is 100-200 fmol.