Jan 09, 2023
Assembly of pAOXHygR vector for protein expression in the yeast Pichia pastoris
- 1Tallinn University of Technology
Protocol Citation: Kaia Kukk 2023. Assembly of pAOXHygR vector for protein expression in the yeast Pichia pastoris. protocols.io https://dx.doi.org/10.17504/protocols.io.kxygx9pdzg8j/v1
Manuscript citation:
Kukk, K. (2023) Identification, characterisation and recombinant expression of flavonoid 3’,5’-hydroxylases and cytochrome P450 reductases fromVaccinium species. bioRxiv 2023.01.09.523147; doi: https://doi.org/10.1101/2023.01.09.523147
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: October 14, 2022
Last Modified: January 09, 2023
Protocol Integer ID: 71332
Keywords: hygromycin B, Pichia pastoris expression vector
Funders Acknowledgement:
European Regional Development Fund
Grant ID: 1.1.1.2/VIAA/2/18/286
Abstract
The protocol describes assembly of an Pichia pastoris expression vector composed of the following building blocks: alcohol oxidase 1 (AOX1) promoter, multiple cloning site, myc epitope, 6xHis tag, AOX1 terminator, hygromycin B resistance marker, origin of replication and ampicillin resistance marker. The pAOX1HygR expression vector can be used for integrating the gene of interest into the AOX1 locus of the genome of P. pastoris and the subsequent methanol induced intracellular expression of the recombinant protein. Ampicillin resistance marker is employed for selecting the transformed E. coli cells and hygromycin B resistance marker for selecting the transformed P. pastoris cells. The protocol is part of the article "Identification, characterisation and recombinant expression of flavonoid 3',5'-hydroxylases and cytochrome P450 reductases from Vaccinium species". The protocol was created during implementing the project no 1.1.1.2/VIAA/2/18/286 "Optimization of novel plant derived enzyme expression in microorganisms for biotechnological application" funded by European Regional Development Fund.
Image Attribution
The image was created with SnapGene Viewer 1.6.2.
Materials
GeneJET Gel Extraction and DNA Cleanup Micro KitThermo FisherCatalog #K0832
pPICZ A, B, & C Pichia VectorsThermo FisherCatalog #V19020
CloneJET PCR Cloning KitThermo FisherCatalog #K1231 pUDP082 plasmidaddgeneCatalog #103875 Phusion High-Fidelity DNA Polymerase (2 U/µL)Thermo FisherCatalog #F530L T4 DNA Ligase (5 U/µL)Thermo FisherCatalog #EL0011 Eco31I (BsaI) (10 U/µL)Thermo FisherCatalog #ER0291
BglII (10 U/µL)Thermo FisherCatalog #ER0081
The sequences of the vectors pPICZ A (Thermo Fisher), pUDP082 (Addgene, plasmid #103875) and pJET1.2 (CloneJET PCR Cloning Kit,Thermo Fisher) were stored in the Benchling R&D cloud. The pPICZ A vector was used as a source for the sequence encoding AOX1 promoter followed by multiple cloning site (MCS), myc epitope, 6xHis tag and AOX1 terminator. pUDP086 was used as a template for amplifying hygromycin B resistance marker and pJET1.2 for amplifying ampicillin resistance marker and origin of replication.
The assembly wizard of the Benchling workspace was used to design primers for amplifying DNA fragments with proper overhangs for running Golden Gate assembly. The primer sequences were manually edited (longer) so that the annealing temperatures were at least 63°C. The primer sequences used for obtaining the first two building blocks are presented in the table below (Table 1), whereas the primer prAOX1MCSHis6TT REV eliminated the unwanted Eco31I (BsaI) site from the 3' end of AOX1 transcription terminator. Phusion High-Fidelity DNA polymerase (Thermo Fisher) was used for running PCR according to manufacturer's instructions. The PCR products with the expected size (1420 and 1715 bp) were purified from agarose gel using GeneJet Gel Extraction and DNA Cleanup Micro Kit (Thermo Scientific). DNA concentration was measured with Mettler Toledo UV5nano spectrophotometer.
| A | B | |
| Primer name | Primer sequence | |
| prAOX1MCSHis6TT FWD | TGGACTGGTCTCGTGAGATCTAACATCCAAAGACGAaagg | |
| prAOX1MCSHis6TT REV | TGGACTGGTCTCGgtGCACAAACGAActTCTCACTTAATCTTCTGTACtctgaag | |
| pHygRt FWD | TGGACTGGTCTCCGCactatatgtgaaggcatggctatg | |
| pHygRt REV | TGGACTGGTCTCCACCGttgttgaacattcttaggctg |
Table 1. Primer names and sequences used for amplifying the sequence from AOX1 promoter to transcription terminator from pPICZ A (prAOX1MCSHis6TT FWD vs prAOX1MCSHis6TT REV) and the hygromycin B resistance marker from pUDP082 vector (pHygRt FWD vs pHygRt REV).
The sequence encoding ampicillin resistance in pJET1.2 contains an unwanted Eco31I (BsaI) site that was removed before running the Golden Gate assembly. Silent mutation was introduced (GGG to GGA) through running PCR in two rounds. In the first round the primer pairs below (Table 2) and Phusion High-Fidelity DNA polymerase were used. The PCR products with the expected size (990 and 880 bp) were purified from agarose gel using GeneJet Gel Extraction and DNA Cleanup Micro Kit.
| A | B | C | D | E | |
| Fragment I | oriAmpR FWD | TGGACTGGTCTCCCGGTGAGCAAAAGGCCAGCA | AmpRwoBsaI REV | AGCCGGTGAGCGTGGATCTCGCGGTATCATT | |
| Fragment II | AmpRwoBsaI FWD | AATGATACCGCGAGATCCACGCTCACCGGCT | oriAmpR REV | TGGACTGGTCTCCCTCAGGTGGCACTTTTCGGG |
Table 2. Primers used for amplifying ampicillin resistance marker and origin of replication from pJET1.2 vector.
In the second round of PCR the fragments were joined by carrying out a two-step PCR by combining one microliter of both purified DNA fragments per 50 μl reaction mix, the primers oriAmpR FWD and oriAmpR REV, and dNTPs, HF buffer and Phusion High-Fidelity DNA polymerase, as recommended by the manufacturer. As before, the PCR product with the correct size was purified from agarose gel.
Golden Gate assembly was carried out whereas the molar ratio of the oriAmpR fragment ("backbone") to the inserts - prAOX1MCSHis6TT and HygR was 1:2. 20 μl of the assembly mix contained approximatelly 75 ng of the backbone, 150 ng of both inserts, 2 μl of T4 DNA ligase buffer, 1 μl of Eco31I (BsaI) (Thermo Fisher) and 1 μl of T4 DNA ligase (Thermo Fisher). The assembly reaction was carried out in 250 μl PCR tubes in a PCR machine with the lid heating turned on (105 °C). The programme was as follows: 30 cycles of 2 min at 37 °C followed by 2 min at 16 °C, one cycle of 5 min at 55 °C and one cycle of 5 min of 80 °C.
10 μl of the assembly mix was used for transforming 100 μl of competent E. coli DH5α cells. The transformation mix was plated on LB agar plates (Luria-Bertani, 1% tryptone, 0.5% yeast extract, 1% NaCl, 1.5% agar) containing 75 μg/ml ampicillin. Transformation yielded a lot of colonies confirming that the ampicillin resistance gene was functional. Sequencing with 3'AOX1 primer (GCAAATGGCATTCTGACATCC) was carried out to confirm that MCS was free of errors. P. pastoris GS115H (GS115 with HIS4 phenotype, obtained by transforming GS115 with pPIC3.5 linearised with StuI) was transformed with the empty pAOXHygR vector (linearised with BglII) and plated on YPD agar plates (1% yeast extract, 2% peptone, 2% dextrose, 2% agar) containing 100 μg/ml hygromycin B. Many colonies were obtained, demonstrating that the hygromycin B resistance marker was functional. The vector sequence can be found in the Supplementary files of the manuscript.