Apr 06, 2022
Amplify iTracer Barcode and Scars from 10x cDNA
This protocol is a draft, published without a DOI.
- 1ETHZ - ETH Zurich
Protocol Citation: Ashley Maynard, Sophie Jansen, Giovanna Brancati 2022. Amplify iTracer Barcode and Scars from 10x cDNA. protocols.io https://protocols.io/view/amplify-itracer-barcode-and-scars-from-10x-cdna-b63grgjw
Manuscript citation:
He, Z., Maynard, A., Jain, A. et al. Lineage recording in human cerebral organoids. Nat Methods 19, 90–99 (2022). https://doi.org/10.1038/s41592-021-01344-8
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it’s working
Created: April 02, 2022
Last Modified: April 06, 2022
Protocol Integer ID: 60232
Keywords: lineage tracing, genomic lineage tracer, iTracer, barcodes
Abstract
Induced pluripotent stem cell (iPSC)-derived organoids provide models to study human organ development. Single-cell transcriptomics enable highly resolved descriptions of cell states within these systems; however, approaches are needed to directly measure lineage relationships. Here we establish iTracer, a lineage recorder that combines reporter barcodes with inducible CRISPR–Cas9 scarring and is compatible with single-cell and spatial transcriptomics. We apply iTracer to explore clonality and lineage dynamics during cerebral organoid development and identify a time window of fate restriction as well as variation in neurogenic dynamics between progenitor neuron families. We incorporate gene perturbation (iTracer-perturb) and assess the effect of mosaicTSC2 mutations on cerebral organoid development. Our data shed light on how lineages and fates are established during cerebral organoid formation. More broadly, our techniques can be adapted in any iPSC-derived culture system to dissect lineage alterations during normal or perturbed development.
This protocol describes barcode and scar detection from single-cell cDNA:
Barcode and scar regions were amplified from 60-70ng of cDNA remaining from the single-cell RNAseq preparation with three separate PCR reactions. First cDNA was amplified via PCR broadly targeting a region containing both the scar and barcode. Subsequently, the reaction was split equally and we performed a nested PCR separately targeting the barcode and scar regions. Lastly, we added Illumina sequencing adapters (10x Genomics). Following every PCR reaction the samples were cleaned-up using magnetic beads (Beckman Coulter). Libraries are then ready to be sequenced on Illumina sequencer.
Materials
Olgios needed:
| Primer Name | Assay | Sequence | |
| 10x_Root_RFP_F | scRNAseq amplified libraries | cggcacgctgatctacaagg | |
| 10x_Nest_RFP_F | scRNAseq amplified libraries | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTgagttcaagaccatctacatggcc | |
| 10x_Root_GFP_F | scRNAseq amplified libraries | gacgacggcaactacaagacc | |
| 10x_Nest_GFP_F | scRNAseq amplified libraries | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTaggtgaacttcaagatccgcc | |
| 10x_Universal_R | scRNAseq amplified libraries | CTACACGACGCTCTTCCGATCT | |
| 10x_Nest_Barcode_GFP_F | scRNAseq amplified libraries | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTggatcactctcggcatgga | |
| 10x_Nest_Barcode_RFP_F | scRNAseq amplified libraries | GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTtggaacagtacgagcgctc |
**if using the GFP iTracer please use oligos with _G or _GFP
** if using the RFP iTracer, please use the oligos with _R or _RFP
Set up Reaction 1 (Root PCR)
Set up Reaction 1 (Root PCR)
Make reaction master mix:
| A | B | |
| Component | 1x rxn | |
| 100% DMSO | 1.5uL | |
| 10uM 10x Root PCR GFP F Primer | 2.5uL | |
| 10uM 10x Universal R Primer | 2.5uL | |
| 2x Phusion Ready Mix | 25uL | |
| EvaGreen | 0.75uL | |
| cDNA product (50ng) | 17.75uL total | |
| H2O |
Add 30.75 µL per well of reaction master mix to qPCR plates, then add a total of 17.75 µL of sample.
Run PCR according to the following program:
| A | B | C | D | |
| Step | Temperature | Duration | Cycles | |
| Initial denaturation | 98 ºC | 30 sec | 1 | |
| Denaturation | 98 ºC | 15 sec | 45 cycles & stop when saturated | |
| Annealing | 66 ºC | 15 sec | ||
| Extension | 72 ºC | 20 sec | ||
| Final extension | 72 ºC | 2 min | 1 |
Volume 50 µL + 105 °C lid temperature.
Stop reaction in the exponential phase before the curve levels off (see example)
Example of when to stop PCR reactions.
Clean up reaction with 1:1 SPRI beads (50 µL beads added). Elute in 30 µL EB buffer
Check concentrations of reactions on Nanodrop.
Set up Reaction 2a (Nested PCR for Barcodes)
Set up Reaction 2a (Nested PCR for Barcodes)
Make reaction master mix:
| A | B | |
| Component | 1x rxn | |
| 2x Phusion Ready Mix | 25uL | |
| 10uM Nest Barcode GFP Primer | 2.5uL | |
| 10uM 10x Universal R Primer | 2.5uL | |
| EvaGreen | 0.75uL | |
| H20 | 14.25uL | |
| Root PCR Product | 5uL |
Add 45 µL per well of reaction master mix to qPCR plates
Run PCR according to the following program:
| A | B | C | D | |
| Step | Temperature | Duration | Cycles | |
| Initial denaturation | 98 ºC | 30 sec | 1 | |
| Denaturation | 98 ºC | 15 sec | 30 cycles & stop when saturated | |
| Annealing | 65 ºC | 15 sec | ||
| Extension | 72 ºC | 20 sec | ||
| Final extension | 72 ºC | 60 sec | 1 |
Volume 50 µL + 105 °C lid temperature
Stop reaction in the exponential phase before the curve levels off.
Clean up reaction with 1:1 SPRI beads:
Vortex to resuspend the SPRIselect reagent. Add 50 µL SPRIselect Reagent (1X) to each sample. Pipette mix 15x (pipette set to 150 µL ). Incubate 00:05:00 at Room temperature .
Place the magnet on High until the solution clears. Remove 165 µL supernatant. DO NOT discard any beads.
With the tube still in the magnet, add 200 µL 80% ethanol to the pellet. Wait00:00:30 . Remove the ethanol. Repeat steps i and j for a total of 2 washes.
Centrifuge briefly. Place on the magnet on Low. Remove remaining ethanol.
Remove from the magnet. Add 30 µL Buffer EB. Pipette mix 15x. Incubate 2 min at Room temperature .
Place on the magnet on Low until the solution clears. Transfer 30 µL to a new tube strip.
Check concentrations of reactions on Nanodrop.
Set up Reaction 2b (Nested PCR for Scars)
Set up Reaction 2b (Nested PCR for Scars)
Make reaction master mix:
| A | B | |
| Component | 1x rxn | |
| 2x Phusion Ready Mix | 25uL | |
| 10uM Nest GFP Primer | 2.5uL | |
| 10uM 10x Universal R Primer | 2.5uL | |
| EvaGreen | 0.75uL | |
| H20 | 14.25uL | |
| Root PCR Product | 5uL |
Add 45 µL per well of reaction master mix to qPCR plates.
Run PCR according to the following program:
| A | B | C | D | |
| Step | Temperature | Duration | Cycles | |
| Initial denaturation | 98 ºC | 30 sec | 1 | |
| Denaturation | 98 ºC | 15 sec | 30 cycles & stop when saturated | |
| Annealing | 66 ºC | 15 sec | ||
| Extension | 72 ºC | 20 sec | ||
| Final extension | 72 ºC | 60 sec | 1 |
Volume 50 µL + 105 °C lid temperature
Stop reaction in the exponential phase before the curve levels off.
Clean up reaction with 1:1 SPRI beads:
Vortex to resuspend the SPRIselect reagent. Add 50 µL SPRIselect Reagent (1X) to each sample. Pipette mix 15x (pipette set to 150 µL ). Incubate 00:05:00 at Room temperature .
Place the magnet on High until the solution clears. Remove 165 µL supernatant. DO NOT discard any beads.
With the tube still in the magnet, add 200 µL 80% ethanol to the pellet. Wait00:00:30 . Remove the ethanol. Repeat steps i and j for a total of 2 washes.
Centrifuge briefly. Place on the magnet on Low. Remove remaining ethanol.
Remove from the magnet. Add 30 µL Buffer EB. Pipette mix 15x. Incubate 2 min at Room temperature .
Place on the magnet on Low until the solution clears. Transfer 30 µL to a new tube strip.
Check concentrations of reactions on Nanodrop.
Reaction 3 (Indexing PCR with 10x indexes)
Reaction 3 (Indexing PCR with 10x indexes)
3d 0h 10m 30s
3d 0h 10m 30s
Prepare reaction mix:
| A | B | |
| Component | 1x rxn | |
| 2x Phusion Ready Mix | 25ul | |
| 10x SI Primer | 1ul |
Prepare the DNA+H20, normalize PCR products to 60 ng , and fill to 19 µL with water
Add 26 µL of reaction mix to each sample.
Add 10x Index primers 5 µL .
Run PCR according to the following program:
| A | B | C | D | |
| Step | Temperature | Duration | Cycles | |
| Initial denaturation | 98 ºC | 30 sec | 1 | |
| Denaturation | 98 ºC | 15 sec | 30 cycles & stop when saturated | |
| Annealing | 55 ºC | 15 sec | ||
| Extension | 72 ºC | 20 sec | ||
| Final extension | 72 ºC | 2 min | 1 |
Volume 50 µL + 105 °C lid temperature
SPRI Select bead clean-up (double sided clean-up as performed at 10x final clean up, v3.1 revD step 3.6)
Add 50 µL of EB to the PCR reactions to have 100 µL total volume.
Vortex to resuspend the SPRIselect reagent. Add 60 µL SPRIselect Reagent (0.6X) to each sample. Pipette mix 15x (pipette set to 150 µL ). Incubate 00:05:00 at Room temperature .
5m
Place the magnet on High until the solution clears. DO NOT discard supernatant. Transfer 150 µL supernatant to a new tube strip.
Vortex to resuspend the SPRIselect reagent. Add 20 µL SPRIselect Reagent (0.8X) to each sample. Pipette mix 15x (pipette set to 150 µL ). Incubate 00:05:00 at Room temperature .
5m
Place the magnet on High until the solution clears. Remove 165 µL supernatant. DO NOT discard any beads.
With the tube still in the magnet, add 200 µL 80% ethanol to the pellet. Wait00:00:30 . Remove the ethanol. Repeat steps i and j for a total of 2 washes.
30s
Centrifuge briefly. Place on the magnet on Low. Remove remaining ethanol.
Remove from the magnet. Add 35.5 µL Buffer EB. Pipette mix 15x. Incubate 2 min at Room temperature .
Place on the magnet on Low until the solution clears. Transfer 35 µL to a new tube strip.
Run Bioanalyzer (1:10 diluted).
Store at 4 °C for up to 72:00:00 or at -20 °C for long-term storage. Libraries are ready for sequencing!
3d