May 23, 2023

Public workspaceAAV DNA library generation

Forked from a private protocol
DOI
dx.doi.org/10.17504/protocols.io.5jyl8jy89g2w/v1
  • Sripriya Ravindra Kumar1,
  • Timothy F. Shay1,
  • Xinhong Chen1,
  • David Brown1,
  • Tatyana Dobreva1,
  • Qin Huang1,
  • Xiaozhe Ding1,
  • Yicheng Luo1,
  • Pétur H. Einarsson1,
  • Alon Greenbaum1,
  • Min J. Jang1,
  • Benjamin E. Deverman1,
  • Viviana Gradinaru1
  • 1California Institute of Technology
Miguel Chuapoco
Icon indicating open access to content
QR code linking to this content
DOI: dx.doi.org/10.17504/protocols.io.5jyl8jy89g2w/v1
External link: https://rdcu.be/c9RyP
Protocol Citation: Sripriya Ravindra Kumar, Timothy F. Shay, Xinhong Chen, David Brown, Tatyana Dobreva, Qin Huang, Xiaozhe Ding, Yicheng Luo, Pétur H. Einarsson, Alon Greenbaum, Min J. Jang, Benjamin E. Deverman, Viviana Gradinaru 2023. AAV DNA library generation. protocols.io https://dx.doi.org/10.17504/protocols.io.5jyl8jy89g2w/v1
Manuscript citation:
Ravindra Kumar, S., Miles, T.F., Chen, X.et al.Multiplexed Cre-dependent selection yields systemic AAVs for targeting distinct brain cell types.Nat Methods17, 541–550 (2020). https://doi.org/10.1038/s41592-020-0799-7
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License,  which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: May 08, 2023
Last Modified: May 31, 2024
Protocol Integer ID: 81604
Keywords: ASAPCRN
Funders Acknowledgement:
Aligning Science Across Parkinson’s
Grant ID: ASAP-020495
Abstract
This protocol describes how to generate a DNA library of AAV capsid variants diversified by insertion of a randomized sequence encoding 7 amino acids between AA588 and AA589 of AAV9.
Protocol materials
ReagentZymoclean™ Gel DNA Recovery KitZymo ResearchCatalog #D4001
Step 4
ReagentNEBuilder HiFi DNA Assembly Master Mix - 50 rxnsNew England BiolabsCatalog #E2621L
Step 6
ReagentExonuclease V (RecBCD) - 5,000 unitsNew England BiolabsCatalog #M0345L
Step 7
ReagentDNA Clean & Concentrator-5 (Capped) 50 PrepsZymo ResearchCatalog #D4013
Step 8
ReagentSURE 2 Supercompetent CellsAgilent TechnologiesCatalog #200152
Step 9
Reagent293T cell lineATCCCatalog #CRL-3216
Step 12
ReagentQ5 Hot Start High-Fidelity 2X Master Mix - 500 rxnsNew England BiolabsCatalog #M0494L
Step 2
ReagentSmaI - 2,000 unitsNew England BiolabsCatalog #R0141S
Step 11
ReagentPlasmid Safe ATP-Dependent DNaseEpicentreCatalog #E3105K
Step 7
Generation of Library Fragments
Generation of Library Fragments
Design primers for the randomized insertion.
Note
We use a randomized heptamer codon insertion ([NNK] x 7) based on the NNK saturation mutagenesis strategy. This uses degenerate primers containing mixed bases (Integrated DNA Technologies). N can be A, C, G or T; K can be G or T. This strategy yields combinations of all 20 amino acids at each position of the heptamer peptide using 33 codons, resulting in a theoretical library size of 1.28 billion amino acid combinations.

To introduce genetic diversity to the Round 1 library, we use a reverse primer containing 21 degenerate nucleotides ([NNK] x 7) inserted between amino acids 588 and 589 (VP1 numbering) of the cap gene.

The forward primer contains a 20 bp 5' overhang near the XbaI restriction enzyme sequence.

Reverse primers contain a 20 bp 5' overhang near the AgeI restriction enzyme sequence.

Our primer sequences:
XF (forward): ACTCATCGACCAATACTTGTACTATCTCTCTAGAAC
7xMNN-588i (reverse): GTATTCCTTGGTTTTGAACCCAACCGGTCTGCGCCTGTGCMNNMNNMNNMNNMNNMNNMNNTTGGGCACTCTGGTGGTTTGTG

Generate the AAV capsid library fragments by PCR using the AAV9 cap gene as template with ReagentQ5 Hot Start High-Fidelity 2X Master Mix - 500 rxnsNew England BiolabsCatalog #M0494L and forward and reverse primers.

Note
To avoid PCR-induced biases resulting from point mutations, recombination, and template switching, limit PCR amplification to 10-15 cycles and scale up to get the required yield.


Run PCR products on a 1% agarose gel.
Purify the 480 bp band with ReagentZymoclean™ Gel DNA Recovery KitZymo ResearchCatalog #D4001
Note
It is critical to avoid AAV contamination during this step by taking precautionary measures like using a clean gel-running box and freshly prepared 1× TAE buffer.


Library Assembly
Library Assembly
Linearize the rAAV-ΔCap-in-cis-Lox plasmid by restriction digest with AgeI and XbaI
Insert the amplified library fragments into the linearized vector in a 1:2 molar ratio using ReagentNEBuilder HiFi DNA Assembly Master Mix - 50 rxnsNew England BiolabsCatalog #E2621L

Library Purification
Library Purification
Treat with either ReagentPlasmid Safe ATP-Dependent DNaseEpicentreCatalog #E3105K or ReagentExonuclease V (RecBCD) - 5,000 unitsNew England BiolabsCatalog #M0345L to degrade non-assembled DNA fragments remaining in the mixture.

Purify assembled library with ReagentDNA Clean & Concentrator-5 (Capped) 50 PrepsZymo ResearchCatalog #D4013

Library Quality Validation
Library Quality Validation
Transform 1 ng assembled library into ReagentSURE 2 Supercompetent CellsAgilent TechnologiesCatalog #200152 and check for colonies after overnight incubation at 37ºC on LB-agar plates containing carbenicillin.
Sequence the DNA library around the insertion site. A non-biased library should match the diversity of the NNK/NNM motif (N=25% each of A, T, G and C; K=50% each of G and T; M=50% each of A and C) with minor fluctuations.
To verify that the ITRs are intact, digest with ReagentSmaI - 2,000 unitsNew England BiolabsCatalog #R0141S

Transfect Reagent293T cell lineATCCCatalog #CRL-3216 with 10 ng of library. Uniform expression of mNeonGreen should be observed across cells. Measuring the average yield per dish will inform scaling for full production.
Note
Our typical yields are on the order of 0.1 - 1E11 v.g. per 150 mm dish.