Sep 16, 2017
5'RACE (Rapid Amplification of cDNA ends)
- 1Institute for Synthetic Biology, Heinrich-Heine-University Düsseldorf
- Axmann Lab
Protocol Citation: Anna Behle 2017. 5'RACE (Rapid Amplification of cDNA ends). protocols.io https://dx.doi.org/10.17504/protocols.io.jk7ckzn
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
Created: August 29, 2017
Last Modified: March 20, 2018
Protocol Integer ID: 7551
Abstract
This protocol can be used for mapping transcriptional start site(s) (TSS) of a specific gene of interest in bacteria.
By slightly modifying this protocol, whole transcriptome TSS could also potentially be mapped.
Guidelines
When handling RNA, samples should always be kept cold (on ice) and in an RNase-free environment. Wear gloves, wipe down surfaces with RNase-Away, use separate, RNase-free water for reactions. As a precautionary measure, samples stored long-term (> 1 month) should be kept at -80 °C.
Before starting, check the integrity of the total RNA on a formaldehyde agarose gel to check for degradation.
Materials
MATERIALS
DNase I (RNase-free) - 1,000 unitsNew England BiolabsCatalog #M0303S
RNA 5’ Pyrophosphohydrolase (RppH) - 200 unitsNew England BiolabsCatalog #M0356S
Q5 High-Fidelity DNA Polymerase - 500 unitsNew England BiolabsCatalog #M0491L
T4 RNA Ligase 1 (ssRNA Ligase) (30,000 units/ml) - 5,000 unitsCatalog #M0437M
SuperScript® III First-Strand Synthesis SystemThermo ScientificCatalog #18080-051
T4 Polynucleotide Kinase - 500 unitsNew England BiolabsCatalog #M0201S
RiboLock RNase InhibitorThermo ScientificCatalog #EO0381
FastAP Thermosensitive Alkaline PhosphataseThermo ScientificCatalog #EF0654
STEP MATERIALS
TURBO DNA-free™ KitThermo ScientificCatalog #AM1907
RiboLock RNase InhibitorThermo ScientificCatalog #EO0381
Roti Aqua P/C/ICarl RothCatalog #X985.1
RNA 5’ Pyrophosphohydrolase (RppH) - 200 unitsNew England BiolabsCatalog #M0356S
T4 RNA Ligase 1 (ssRNA Ligase) - 1,000 unitsNew England BiolabsCatalog #M0204S
SuperScript® III First-Strand Synthesis SystemThermo ScientificCatalog #18080-051
RNase H - 250 unitsNew England BiolabsCatalog #M0297S
TURBO DNA-free™ KitThermo ScientificCatalog #AM1907
RiboLock RNase InhibitorThermo ScientificCatalog #EO0381
Roti Aqua P/C/ICarl RothCatalog #X985.1
RNA 5’ Pyrophosphohydrolase (RppH) - 200 unitsNew England BiolabsCatalog #M0356S
T4 RNA Ligase 1 (ssRNA Ligase) - 1,000 unitsNew England BiolabsCatalog #M0204S
SuperScript® III First-Strand Synthesis SystemThermo ScientificCatalog #18080-051
RNase H - 250 unitsNew England BiolabsCatalog #M0297S
Protocol materials
RNA 5’ Pyrophosphohydrolase (RppH) - 200 unitsNew England BiolabsCatalog #M0356S
RNA 5’ Pyrophosphohydrolase (RppH) - 200 unitsNew England BiolabsCatalog #M0356S
Roti Aqua P/C/ICarl RothCatalog #X985.1
RNA 5’ Pyrophosphohydrolase (RppH) - 200 unitsNew England BiolabsCatalog #M0356S
SuperScript® III First-Strand Synthesis SystemThermo ScientificCatalog #18080-051
RiboLock RNase InhibitorThermo ScientificCatalog #EO0381
SuperScript® III First-Strand Synthesis SystemThermo ScientificCatalog #18080-051
RiboLock RNase InhibitorThermo ScientificCatalog #EO0381
Q5 High-Fidelity DNA Polymerase - 500 unitsNew England BiolabsCatalog #M0491L
RNase H - 250 unitsNew England BiolabsCatalog #M0297S
T4 RNA Ligase 1 (ssRNA Ligase) (30,000 units/ml) - 5,000 unitsCatalog #M0437M
T4 Polynucleotide Kinase - 500 unitsNew England BiolabsCatalog #M0201S
RiboLock RNase InhibitorThermo ScientificCatalog #EO0381
FastAP Thermosensitive Alkaline PhosphataseThermo ScientificCatalog #EF0654
T4 RNA Ligase 1 (ssRNA Ligase) - 1,000 unitsNew England BiolabsCatalog #M0204S
T4 RNA Ligase 1 (ssRNA Ligase) - 1,000 unitsNew England BiolabsCatalog #M0204S
SuperScript® III First-Strand Synthesis SystemThermo ScientificCatalog #18080-051
DNase I (RNase-free) - 1,000 unitsNew England BiolabsCatalog #M0303S
Roti Aqua P/C/ICarl RothCatalog #X985.1
RNase H - 250 unitsNew England BiolabsCatalog #M0297S
TURBO DNA-free™ KitThermo ScientificCatalog #AM1907
TURBO DNA-free™ KitThermo ScientificCatalog #AM1907
RiboLock RNase InhibitorThermo ScientificCatalog #EO0381
TURBO DNA-free™ KitThermo ScientificCatalog #AM1907
Roti Aqua P/C/ICarl RothCatalog #X985.1
RNA 5’ Pyrophosphohydrolase (RppH) - 200 unitsNew England BiolabsCatalog #M0356S
T4 RNA Ligase 1 (ssRNA Ligase) - 1,000 unitsNew England BiolabsCatalog #M0204S
SuperScript® III First-Strand Synthesis SystemThermo ScientificCatalog #18080-051
RNase H - 250 unitsNew England BiolabsCatalog #M0297S
Safety warnings
PC/I is toxic, handle with care (wear gloves, protective goggles and lab coat).
Before start
Oligos used:
| 5RACE_RNA | rGrUrG rArUrC rCrArA rCrCrG rArCrG rCrGrA rCrArA rGrCrU rArArU rGrCrA rArGrA rNrNrN | |
| Adapter_Prim_1 | TGATCCAACCGACGCGAC | |
| Adapter_Prim_2 (nested) | ACCGACGCGACAAGCTAATGC |
The image below shows three gene specific primers that anneal in the G.O.I for nested PCR. Blue marks the intergenic region to be mapped, most likely containing the TSS.
Growth, harvesting, RNA isolation
Growth, harvesting, RNA isolation
Prepare bacterial culture using culture conditions of choice (e.g. high salt, oxidative stress, etc.)
Harvest cells and extract total RNA.
Protocol
NAME
Isolation of total RNA from Synechocystis (PGTX method)CREATED BY
Anna Behle
Grow cyanobacteria to an OD750 of ~1.
Fill a 50 mL tube with ice. Add culture until full (approx. 25 mL)
Centrifuge tube 5 min at maximum speed.
00:05:00
Discard supernatant. Resuspend cyanobacterial pellet in the remaining water (~1mL)
Transfer to a fresh 2 mL tube. Spin down 1 min at maximum speed.
00:01:00
Resuspend pellet in 1 mL PGTX solution. Flash freeze and store at -80˚C for later extraction, or proceed with the next step.
PGTX
Safety information
PGTX contains phenol; wear safety gear and gloves
Heat samples at 95˚C in a shaking heat block. Vortex samples from time to time to ensure complete lysis.
00:05:00
Place samples on ice for 5 min.
00:05:00
Add 700 µL Chloroform/IAA. Mix well. Incubate at RT for 10 min, vortexing from time to time.
00:10:00
Safety information
Wear safety gear
Centrifuge samples at maximum speed for 10 min to separate phases.
Transfer aqueous phase to a fresh tube.
00:10:00
Add 1 vol Chloroform/IAA. Mix well by vortexing. Centrifuge 10 min at maximum speed.
Transfer aqueous phase to a fresh tube.
00:10:00
Add 3 vol. of 100 % EtOH + NaOAc 10:1 to the sample. Mix well.
Precipitate 1 h at -80˚C or over night at -20˚C.
Centrifuge precipitated sample at 4˚C and maximum speed for at least 30 min.
Remove supernatant, making sure not to disrupt the RNA pellet.
00:30:00
Wash pellet with 70% EtOH.
Centrifuge for 15 min, 4˚C at maximum speed.
Completely remove supernatant.
Dry at RT for ~5 min. Do not overdry!
Resuspend pellet in 40 µL pure, RNase-free water.
DNase I digest
DNase I digest
30 µg total RNA
4 µL 10x DNase I buffer
3 µL DNase I
1 µL RNase Inhibitor (e.g. RiboLock, ThermoScientific)
H2O ad 40 µL
Incubate 30 min at 37˚C
TURBO DNA-free™ KitThermo ScientificCatalog #AM1907
00:30:00
RiboLock RNase InhibitorThermo ScientificCatalog #EO0381
Add 1 vol. Roti Aqua P/C/I. Mix well, then centrifuge at 4˚C for 10 min at maximum speed.
Transfer to a fresh tube.
Roti Aqua P/C/ICarl RothCatalog #X985.1
00:10:00
Add 1/10 vol 3M NaOAc, pH=5.3, + 3 vol 100% EtOH.
Precipitate RNA at -20˚C over night.
Centrifuge 30 min at maximum speed and 4˚C. Discard supernatant.
Wash with 500 µL 70% EtOH. Centrifuge 15 min, 4˚C at maximum speed. Completely remove supernatant. Dry pellet for 5 min.
Resuspend RNA in 60 µL RNase-free water.
PPi-removal
PPi-removal
RppH removes pyrophosphate from triphosphorylated ends of mRNA (primary transcripts in bacteria).
+RppH: Both Both primary (formerly triphosphorylated) and degraded RNA can be linked to the adapter.
-RppH: Only degraded (pyrophosphate removed) can be linked to adapter.
+Alkaline phosphatase:Negative control; no ligation possible because all 5'phosphates are removed.
| 1 | 2 | 3 | |
| +RppH | -RppH | +FastAP | |
| 5µg DNase-treated RNA | 5µg DNase-treated RNA | 5µg DNase-treated RNA | |
| 10 µL 10x NEB 2 buffer | 10 µL 10x NEB 2 buffer | 10 µL 10x FastAP buffer | |
| 5 µL RppH | 5 µL H2O | 5 µL FastAP | |
| 1 µL RNase Inhibitor | 1 µL RNase Inhibitor | 1 µL RNase Inhibitor | |
| H2O ad 100 µL | H2O ad 100 µL | H2O ad 100 µL |
Incubate for 1 h at 37˚C.
Possible positive control:
+PNK: labels all dephosphorylated mRNA with a 5' phosphate.
Note
When working with eukaryotic RNA, RppH can also be used for decapping, but NEB 10x Thermopol buffer needs to be purchased instead of NEBuffer 2.
RNA 5’ Pyrophosphohydrolase (RppH) - 200 unitsNew England BiolabsCatalog #M0356S
Inactivation of enzymes:
Add 1 vol. Roti Aqua P/C/I. Mix well, then centrifuge at 4˚C for 10 min at maximum speed.
Transfer to a fresh tube.
Add 1/10 vol 3M NaOAc, pH=5.3, + 3 vol 100% EtOH + 1 µL glycogen (ThermoScientific, RNA-grade)
Precipitate RNA at -20˚C over night.
Centrifuge 30 min at maximum speed and 4˚C. Discard supernatant.
Wash with 500 µL 70% EtOH. Centrifuge 15 min, 4˚C at maximum speed. Completely remove supernatant. Dry pellet for 5 min.
Resuspend RNA in 67 µL (1, 3) / 134 µL (2) RNase-free water.
RNA-adapter ligation to 5'-end
RNA-adapter ligation to 5'-end
5´-RNA-oligo linker:
GUGAUCCAACCGACGCGACAAGCUAAUGCAAGANNN 5´
T4 RNA Ligase 1 catalyzes the ligation of 5' phosphorylated ssRNA to 3' OH.
5'-end of RNA oligo should not be phosphorylated. This will prevent undesired ligation to mRNA 3' end.
| 1 (+RppH) | 2a (-RppH) | 2b (-RppH) | 3 (+FastAP) | ||
| treated RNA | 67 µL | 67 µL | 67 µL | 67 µL | |
| RNase Inh. | 2 µL | 2 µL | 2 µL | 2 µL | |
| 10x Ligase buffer | 10 µL | 10 µL | 10 µL | 10 µL | |
| RNA Oligo linker | 1 µL | 1 µL | / | 1 µL | |
| ATP (10 mM) | 10 µL | 10 µL | 10 µL | 10 µL | |
| T4 RNA Ligase 1 | 10 µL | 10 µL | 10 µL | 10 µL |
Incubate 1 hour at 37˚C (or, alternatively, 12 h at 17˚C)
T4 RNA Ligase 1 (ssRNA Ligase) - 1,000 unitsNew England BiolabsCatalog #M0204S
Inactivation of enzymes:
Add 1 vol. Roti Aqua P/C/I. Mix well, then centrifuge at 4˚C for 10 min at maximum speed.
Transfer to a fresh tube.
Add 1/10 vol 3M NaOAc, pH=5.3, + 3 vol 100% EtOH + 1 µL glycogen (ThermoScientific, RNA-grade)
Precipitate RNA at -20˚C over night, or at least 1 h at -80˚C
Centrifuge 30 min at maximum speed and 4˚C. Discard supernatant.
Wash with 500 µL 70% EtOH. Centrifuge 15 min, 4˚C at maximum speed. Completely remove supernatant. Dry pellet for 5 min.
Resuspend in 20 µL RNase-free water.
cDNA synthesis
cDNA synthesis
5 µL linked RNA (add H2O up to 32.5 µL)
2 pmol gene specific primer 1 (0.2 µL of 10µM stock)
Combine RNA and gene-specific primer; denature at 95˚C for 5 min, then chill on ice.
10 µL 5x First strand buffer
1 µL 10 µM dNTPs
1 µL RNase Inhibitor (e.g. RiboLock, ThermoScientific)
2.5 µL 0.1 M DTT
2 µL Superscript III
Incubate 1 hour at 55 ˚C.
SuperScript® III First-Strand Synthesis SystemThermo ScientificCatalog #18080-051
Add 1 µL RNase H; incubate at 37˚C for 20 min.
RNase H - 250 unitsNew England BiolabsCatalog #M0297S
Note
RNase H specifically removes RNA from DNA:RNA hybrid molecules, but not ss- or dsDNA.
Add 1 vol. Roti Aqua P/C/I. Mix well, then centrifuge at 4˚C for 10 min at maximum speed.
Transfer to a fresh tube.
Add 1/10 vol 3M NaOAc, pH=5.3, + 3 vol 100% EtOH + 1 µL glycogen (ThermoScientific, RNA-grade)
Precipitate RNA at -20˚C over night, or at least 1 h at -80˚C
Centrifuge 30 min at maximum speed and 4˚C. Discard supernatant.
Wash with 500 µL 70% EtOH. Centrifuge 15 min, 4˚C at maximum speed. Completely remove supernatant. Dry pellet for 5 min.
Resuspend cDNA in 21 µL RNase-free water.
RACE-PCR
RACE-PCR
Perform a PCR with Adapter-specific primer and one nested gene specific primer.
5 µL 5x Q5 rxn buffer
5 µL 5x High GC buffer
0.5 µL Adapter-Primer 1
0.5 µL Gene specific primer (nested)
0.5 µL dNTPs
4 µL cDNA
0.5 µL Q5 Polymerase
H2O ad 25 µL
Cycling conditions:
98˚C 2 min
98˚C 10 sec |
xx˚C 5 sec | repeat 30-35x
72˚C 10 sec |
72˚C 5 min
Make sure to include a control PCR on DNase-treated RNA to ensure there is no genomic contamination.
Sequencing
Sequencing
Run PCR products on a 1.8% agarose gel for approx. 1.5 h, or, in case of very small fragments, a 3% NuSieve Agarose gel.
If an RppH+-specific band is observed:
Excise and gel-extract band with the highest molecular weight.
To increase specificity, an additional PCR with nested primers may need to be performed.
Note
It is possible that a gene contains multiple TSS. In case of multiple +RppH specific bands, all of them should be analyzed.
Subclone RACE-PCR fragment into cloning vector of choice, e.g. pJET or TOPO.
Transform DH5α with ligation mix.
Perform colony PCR on colonies from transformation to ensure successful ligation.
In the case of positive clones, purify the plasmids and sequence them.
At least five, possibly more, should be analyzed.