Aug 21, 2020
2: User-friendly protocol: Oligo ordering and preparation (SABER-FISH)
This protocol is a draft, published without a DOI.
- Jocelyn Y. Kishi1,2,3,
- Sylvain W. Lapan4,3,
- Brian J Beliveau1,2,5,3,6,
- Emma R. West4,3,
- Allen Zhu1,2,
- Hiroshi M. Sasaki1,2,
- Sinem K Saka1,2,
- Yu Wang1,2,
- Constance L Cepko4,7,6,
- Peng Yin1,2,6
- 1Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, MA, USA;
- 2Department of Systems Biology, Harvard Medical School, Boston, MA, USA;
- 3These authors contributed equally;
- 4Department of Genetics, Blavatnik Institute, Harvard Medical School, Boston, MA, USA;
- 5Present address: Department of Genome Sciences, University of Washington, Seattle, WA, USA;
- 6Correspondence: py@hms.harvard.edu (P.Y.), cepko@genetics.med.harvard.edu (C.L.C.), beliveau@uw.edu (B. J. B.);
- 7Howard Hughes Medical Institute, Chevy Chase, MD, USA
- Human Cell Atlas Method Development Community
External link: http://saber.fish/
Protocol Citation: Jocelyn Y. Kishi, Sylvain W. Lapan, Brian J Beliveau, Emma R. West, Allen Zhu, Hiroshi M. Sasaki, Sinem K Saka, Yu Wang, Constance L Cepko, Peng Yin 2020. 2: User-friendly protocol: Oligo ordering and preparation (SABER-FISH). Protocol exchange https://protocols.io/view/2-user-friendly-protocol-oligo-ordering-and-prepar-bh9gj93w
Manuscript citation:
Kishi, J.Y., Lapan, S.W., Beliveau, B.J. et al. SABER amplifies FISH: enhanced multiplexed imaging of RNA and DNA in cells and tissues. Nat Methods 16, 533–544 (2019). https://doi.org/10.1038/s41592-019-0404-0
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
Created: July 06, 2020
Last Modified: August 21, 2020
Protocol Integer ID: 38920
Keywords: olio, probe oligos, ordering, preparation,
Abstract
This protocol is about oligo ordering and preparation.
Note
Attachments
Materials
Probe oligos are ordered from IDT in a 96 well format with standard desalting. Cost is significantly reduced by ordering plates at 10 nanomole synthesis scale.
Additional ordering specs are:
- Resuspended in IDTE 7.5
- v bottom plate
- normalized in nanomoles
Individual wells from the plate can be pooled by multichannel pipetting equal volumes from all wells into a trough. IDTE 7.5 is used for dilutions of probe primers down to 10 micromolar (µM) .
PER30 hairpins typically function well if synthesized with standard desalting and a polyT of 7 T’s on the 3’ end of the hairpin (unless the primer sequence ends in a A bases, in which case the 3’ tail should be designed to not hybridize to the concatemer sequence). They can be resuspended in IDTE (7.5 ) and stored as 100 micromolar (µM) stocks. Dilutions of hairpin down to 5 micromolar (µM) for extension are also done in IDTE. Certain hairpins, however, require the addition of an Inverted dT (InvdT) at the 3’ end and HPLC purification (see Step 1).
Fluorescent oligos are ordered with a 5’ fluorescent adduct and require HPLC purification. Yield is variable and cost is significantly reduced by ordering in bulk. These are resuspended in ddH2O or IDTE to 100 micromolar (µM) for storage, or as 10 micromolar (µM) dilutions (diluted in ddH2O or IDTE). A 3’ InvdT on fluorescent oligo is not essential. A full list of primers, hairpins, and branches are available in 
Supplementary Table 1.xlsx (available on the Nature Methods website).
Supplementary Table 1.xlsx (available on the Nature Methods website). Safety warnings
For hazard information and safety warnings, please refer to the SDS (Safety Data Sheet).
To generate a catalytic (telomerase-like) hairpin corresponding to the primers sequence (RC = reverse complement):
A(primer sequence)GGGCCTTTTGGCCC(RC of primer sequence)T(RC of primer sequence)/3InvdT/
For example, given the primer 27 sequence of CATCATCAT, the catalytic hairpin h.27.27 sequence would be:
ACATCATCATGGGCCTTTTGGCCCATGATGATGTATGATGATG/3InvdT/
The /3InvdT/ can be replaced with TTTTTTT for most hairpins to save cost. We have found empirically however, that some hairpins (including those for primers 25, 32, and 41 seem to require the InvdT modification).
To change the primer appended to a probe set, a hairpin for primer switching (‘re-mapping’) can be used (Fig. S1a-c). Remapping hairpin is introduced in the same reaction as the catalytic hairpin, and the concentration is flexible (0.05 micromolar (µM) -0.25 micromolar (µM) ). Reactions involving primer switching may require additional time for extension to equivalent lengths.
Figure S1: Designing PER primer re-mapping reactions. a, Standard PER setup, which uses one PER hairpin to concatemerize the a sequence. b, Re-mapping PER setup, which uses an additional re-mapping hairpin to swap one sequence for another (in this case, b for a). c, Design example for primer re-mapping primer (A)CAACTTAAC to repeats of sequence (A)CATCATCAT.
To generate a hairpin for primer switching:
A(new primer)GGGCCTTTTGGCCC(RC of new primer)T(RT of old primer sequence)/3InvdT/
A detailed schematic for designing such a hairpin can be seen in Fig. S1c. Here, as above, /3InvdT/ can generally be replaced with TTTTTTT for most hairpins to save cost.
Fluorescent oligos are designed as follows:
/5dye/TT(RC of primer sequence)T(RC of primer sequence)T
This represents a 20mer binding sequence with a 5’ conjugated dye linked to the binding region by a TT’ linker
PER primer re-mapping
PER primer re-mapping
Probe sets with one primer (e.g. primer sequence a) that have to be used in the same experiment with another set that has the same primer (a) can be re-mapped to alternate PER concatemer sequences using a two-hairpin reaction (Fig. S1a-b).
An example for designing re-mapping hairpins given a starting primer sequence and desired concatemer sequence is depicted in Fig. S1c. (The original 9 nt primer sequence is not predicted to hybridize to the complementary 20mer imager sequence at 37°C in 1×PBS, so one of the probe sets can usually be concatemerized with the original primer sequence. In this case it is good to have a control condition with just that probe set missing to verify no cross-talk between channels.)
Figure S1: Designing PER primer re-mapping reactions. a, Standard PER setup, which uses one PER hairpin to concatemerize the a sequence. b, Re-mapping PER setup, which uses an additional re-mapping hairpin to swap one sequence for another (in this case, b for a). c, Design example for primer re-mapping primer (A)CAACTTAAC to repeats of sequence (A)CATCATCAT.