MIOP Term | Value | |
methodology category | omics analysis | |
project | Monterey Bay Time Series | |
purpose | time series design [OBI:0500020] | |
analyses | amplicon sequencing assay[OBI:0002767] | |
geographic location | Monterey Bay [GAZ:00002509] | |
broad-scale environmental context | marine biome [ENVO:00000447] | |
local environmental context | upwelling [ENVO:01000005] | |
environmental medium | sea water [ENVO:00002149] | |
target | 18S Ribosomal RNA [NCIT:C48172] | |
creator | Kathleen Johnson Pitz | |
materials required | ||
skills required | laboratory technician with experience in PCR | |
time required | ||
personnel required | 1 | |
language | en | |
issued | ||
audience | scientists | |
publisher | Monterey Bay Aquarium Research Institute, Chavez Lab | |
hasVersion | ||
license | ||
maturity level | Demonstrated |
PREPARED BY All authors known to have contributed to the preparation of this protocol, including those who filled in the template. | AFFILIATION | ORCID (visit https://orcid.org/ to register) | DATE | |
Jacoby Baker | MBARI | yyyy-mm-dd | ||
Kobun Truelove | MBARI | yyyy-mm-dd | ||
Kathleen Johnson Pitz | MBARI | 0000-0002-4931-8592 | 2022-04-25 |
VERSION | RELEASE DATE This is the date when a given protocol version was finalised | DESCRIPTION OF REVISIONS Please include a brief description of what was changed relative to the previous version | |
1.0.0 | 2022-04-25 | Initial release |
PROTOCOL NAME AND LINK | VERSION The version of the protocol you linked to | RELEASE DATE This is the date corresponding to the version listed to the left | |
protocol_18S_secondary_amplification.md | yyyy-mm-dd | ||
protocol_18S_sequencing.md | yyyy-mm-dd |
EXTERNAL PROTOCOL NAME AND LINK | ISSUER / AUTHOR Please note who authored the protocol (this may also be a company name) | ACCESS DATE This is the date you downloaded or scanned the protocol and uploaded it. | |
Environmental DNA (eDNA) 18S metabarcoding Illumina MiSeq NGS PCR Protocol V.2 https://dx.doi.org/10.17504/protocols.io.n2vdge6 dx.doi.org/10.17504/protocols.io.n2vdge6 | Collin Closek, Anni Djurhuus, Katie Pitz, Ryan Kelly, Reiko Michisaki, Kristine Walz, Hilary Starks, Francisco Chavez, Alexandria Boehm, Mya Breitbart | yyyy-mm-dd | |
18S Illumina Amplicon Protocol https://earthmicrobiome.org/protocols-and-standards/18s/ dx.doi.org/10.17504/protocols.io.nuvdew6 | Earth Microbiome Project | yyyy-mm-dd |
ACRONYM / ABBREVIATION | DEFINITION | |
MBARI | Monterey Bay Aquarium Research Institute | |
PCR | polymerase chain reaction | |
NTC | no template control |
SPECIALISED TERM | DEFINITION | |
amplicon | A piece of DNA or RNA that is the source and/or product of amplification or replication events (https://en.wikipedia.org/wiki/Amplicon) |
DESCRIPTION e.g. filter | PRODUCT NAME AND MODEL Provide the official name of the product | MANUFACTURER Provide the name of the manufacturer of the product. | QUANTITY Provide quantities necessary for one application of the standard operating procedure (e.g. number of filters). | REMARK For example, some of the consumable may need to be sterilized, some commercial solution may need to be diluted or shielded from light during the operating procedure. | |
Durable equipment | |||||
ultraviolet light source [OBI:0002900] | |||||
PCR instrument [OBI:0000989] | |||||
electrophoresis system [OBI:0001053] | |||||
fluorometer [OBI:0400143] | FMAX Fluorometer | Molecular Devices | with SoftMaxPro v1.3.1 | ||
Consumable equipment | |||||
Agarose gel | 2 | ||||
Agencourt AMPure XP bead system | Beckman Coulter, USA | ||||
Quant-It Picogreen dsDNA Assay | Life Technologies | ||||
Chemicals | |||||
10% Bleach | |||||
70% Ethanol | |||||
RNase Away | |||||
Amplitaq Gold Fast PCR mastermix | |||||
molecular-biology grade water | |||||
forward and reverse primers (5 μM) |
PCR Primer Name | Direction | Sequence (5’ -> 3’) | |
Euk1391F and Fluidigm CS1 | forward | ACACTGACGACATGGTTCTACAGTACACACCGCCCGTC | |
EukBr and Fluidigm CS2 | reverse | TACGGAGCAGAGACTTGGTCTTGATCCTTCTGCAGGTTCACCTAC |
PCR step | Temperature | Duration | Repetition | |
denature | 95° C | 10 minutes | 1 | |
denature | 94° C | 45 seconds | 35 | |
anneal | 57° C | 30 seconds | 35 | |
extension | 68 °C | 90 seconds | 35 | |
extension | 72° C | 10 minutes | 1 | |
hold | 4° C | infinity | 1 |