Nov 15, 2024
18 Loci Variant Installation Protocol (ABE)-LDLuptake
Forked from ChrX Variant Installation Protocol
- Quang Vinh Phan1,
- Jayoung Ryu2,
- Tian Yu1,
- Guillaume Lettre3,
- Luca Pinello2,
- Daniel E. Bauer4,
- Benjamin P. Kleinstiver5,
- Richard Sherwood1
- 1Division of Genetics, Department of Medicine, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA, USA;
- 2Molecular Pathology Unit and Center for Cancer Research, Massachusetts General Hospital Research Institute, Department of Pathology, Harvard Medical School, Boston, USA;
- 3Department of Medicine, Faculty of Medicine, Université de Montréal, Montreal, Quebec, Canada;
- 4Division of Hematology/Oncology, Boston Children’s Hospital, Department of Pediatrics, Harvard Medical School, Boston, USA;
- 5Center for Genomic Medicine, Department of Pathology, Massachusetts General Hospital, Harvard Medical School, Boston, MA, USA
Protocol Citation: Quang Vinh Phan, Jayoung Ryu, Tian Yu, Guillaume Lettre, Luca Pinello, Daniel E. Bauer, Benjamin P. Kleinstiver, Richard Sherwood 2024. 18 Loci Variant Installation Protocol (ABE)-LDLuptake. protocols.io https://dx.doi.org/10.17504/protocols.io.eq2ly638egx9/v1
License: This is an open access protocol distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited
Protocol status: Working
We use this protocol and it's working
Created: November 12, 2024
Last Modified: November 15, 2024
Protocol Integer ID: 111995
Funders Acknowledgement:
Pinello
Grant ID: HG012010
Abstract
Genome-wide association studies (GWAS) have identified numerous single nucleotide polymorphisms (SNPs) associated with various traits and diseases, yet understanding the functional consequences of these variants remains challenging. We have chosen a set of 18 loci associated with cholesterol traits (LDL-C and HDL-C) in a recent trans-ancestry GWAS (Graham et al 2021, Nature, GLGC consortium). Genes within these loci have coding burden for these same traits and/or are known monogenic disease genes, and importantly, targeting these genes gives robust phenotypes in CRISPR screens using cholesterol-related phenotypic assays. We have used human genetic evidence to select ~2,500 variants within these 18 loci to evaluate, including variants with strong GWAS evidence and variants with strong evidence as liver eQTLs through fine-mapping and/or linkage to sentinel variants.
This protocol describes pooled LDL uptake screen using CRISPR base editing screening to install all variants in a human hepatocyte cell line, with the goal of gaining insight into causal variants and genes at the selected 18 loci.
Guide library Cloning
Guide library Cloning
Library structure
5'flank-[19-20-nt gRNA]-FEscaffold-terminator-[32-nt target][4-nt barcode]-revcomp-r2seq-[14-nt BE sublibrary primer]
tggaaaggacgaaacaccg[19-20-nt gRNA] GTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT [32-nt target (6-nt upstream, 20-nt gRNA, 6-nt PAM)][4-nt barcode] AGATCGGAAGAGCACACG
Reconstitution of ssDNA oligo pool
Spin down lyophilized ssDNA oligo pool
Prepare 2 ng/µL stock by resuspending in TE buffer with low EDTA (10mM Tris-Cl pH 8.0, 0.1 mM EDTA)
Store at -20 °C.
Restriction digest of CRISPRv2FE-ABE8e-SpRY-BsrGI library backbone
Cut 10 µg CRISPRv2FE-ABE8e-SpRY-BsrGI with BsmBI-V2 and BsrGI-HF
Restriction digest reaction mix overview:
| A | B | |
| H2O | ad 100 µl | |
| NEB 3.1 | 10 µL | |
| CRISPRv2FE-ABE8e-SpRY-BsrGI | 10 µg | |
| BsmBI-v2 | 10 units | |
| BsrGI-HF | 10 units |
Incubate at 55 °C for 3-4 hours with BsmBI-V2, then add BsrGI-HF and incubate at 37°C for another 3-4 hours.
Run digest on 1% agarose gel with SYBR and cut out band at 13.7 kbp.
Amplification of library
Amplification of library done with the following primers:
010415_sgRNA_60bp_fw
TAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAACACCG
030322_r2seq_6ntbc_BsrGrv
TTTAAAACTTTATCCATCTTTGCATGTACAGAAGACGGCATACGAGATCTNNNNNNGTGACTGGAGTTCAGA
CGTGTGCTCTTCCGATCT
Determination of optimal PCR cycles for library amplification
Run a qPCR with 0.5 µl of 1122_18LDLlocus_ABE_gRNAlib library in 15 µl qPCR to determine optimal cycles using the primers above.
qPCR mix
| A | B | |
| Oligo pool | 0.5 uL | |
| 2x Q5 mix | 7.5 uL | |
| F primer @20uM | 0.375 uL | |
| R primer @20uM | 0.375 uL | |
| dd H20 | 5.5 uL | |
| 20x EVA Green | 0.75 |
qPCR program
| A | B | C | D | E | F | |
| 98 °C | 98 °C | 65 °C | 72 °C | 72 °C | 4 °C | |
| 30 sec | 10 sec | 30 sec | 60 sec | 5 min | remaining |
Repeat steps B-D for 20x
Identify the cycle number where the qPCR stops log-linear increase (this is typically 4-5 cycles after the CT), determine how much more input in PCR as in qPCR and subtract the log2 ratio (e.g. if using 0.5 uL, keep as is, if using 1 uL, subtract 1 cycle, if using 2 uL, subtract 2 cycles), to identify PCR1 cycle number.
Library amplification
Once optimal cycle number is determined, run a 100 µl PCR with the following conditions:
| A | B | |
| Oligo pool | 0.5 uL | |
| 2x Q5 mix | 50 uL | |
| F primer @20uM | 2.5 uL | |
| R primer @20uM | 2.5 uL | |
| dd H20 | 44.5 uL |
| A | B | C | D | E | F | |
| 98 °C | 98 °C | 65 °C | 72 °C | 72 °C | 4 °C | |
| 30 sec | 10 sec | 30 sec | 60 sec | 5 min | remaining |
Repeats steps B-D with the determined optimal cycle numbers.
Load PCR onto a 2% agarose gel with SYBR and gel purify band at 299 bp.
Gibson assembly
| A | B | |
| 2xNEB HiFi assembly mix | 50 ul | |
| Digested CRISPRv2FE-ABE8e-SpRY-BsrGI | 2100 ng (0.25 pmol) | |
| Purified library PCR | 140 ng (0.75 pmol) | |
| Water | ad 100 ul |
Incubate at 50°C for 1 hour.
Cleanup/concentration
Add 1 ul GlycoBlue, 2 ul 50mM NaCl, 100 ul Isopropanol to the Gibson reaction system
Vortex, incubate at room temperature for 15 min
SPIN > 15.000 g for 15 min
Carefully remove liquid without disturbing pellet
Wash with 300 ul 80% EtOH and SPIN >15.000 g for 5 min
Remove most liquid with P1000 and spin at >15,000 g for 1 min
Carefully remove all liquid with p200, making sure tube has no liquid left, and air-dry pellet 3-5 min by keeping cap open and leaving at room temp
Add 8.25 ul EB, warming at 55°C for 10min to fully resuspend
Determination of Coverage and Diversity of Cloned Library
Transformation of a small amount of the assembly mix for the determination of diversity and coverage of the cloned library.
Add 0.25 µl of the purified assembled mix into a 1.5 ml tube and gently mix with 25 µl of NEB Stable cells. Incubate for 30 minutes on ice.
Heat shock at 42°C for 30 seconds and put back on ice for 1 minute.
Add 975 µl of NEB 10-beta/Stable Outgrowth Medium and incubate at 30°C for 1 hour while shaking.
Plate 1/10, 1/100, and 1/1,000 of transformation mix onto LB agar plates (supplied with 100 µg/ml ampicillin). Incubate at 30°C overnight.
Calculation of the Coverage
Choose the dilution plate with colony numbers in the range between 20-200 and count the colonies. Calculate the coverage as follows:
((Counted colonies * dilution factor) / Number of library members) * 1600
A coverage of >100x is ideal.
Note: 0.25 µl of the remaining 8 uL purified assembly mix is 32x used in this test. Electroporation with Endura typically yields in a 50x higher transformation efficiency compared to NEB Stable cells, meaning that the entire remaining 8 ul of the assembly mix has 32x50=1600x the number of colonies as the test transformation with 0.25 µl.
Determination of the Diversity
Perform colony PCR on 16 colonies from any of the dilution plates to determined the diversity of the cloned library, using the following conditions:
pX330_seqfw
GAGGGCCTATTTCCCATGAT
111219_postPT_rv
CTAGGCACCGGATCAATTGC
PCR mix for one reaction:
| A | B | |
| NEB OneTaq 2X Master Mix with Standard Buffer | 12.5 µl | |
| Forward Primer @20 µM | 0.25 µl | |
| Reverse Primer @20 µM | 0.25 µl | |
| Water | ad 12 µl |
PCR program:
| A | B | C | D | E | F | |
| 94 °C | 94 °C | 55°C | 72 °C | 72 °C | 4 °C | |
| 30 sec | 15 sec | 30 sec | 60 sec | 5 min | remaining |
Repeat steps B-D for 35x
Load 5 µl of each PCR onto a 2% agarose gel with ethidium bromide and expect bands at 635 bp for successful cloning, while 850 bp indicates plasmid background. If >2 colonies have 850 bp, then re-clone.
Purify rest of the colony PCR via QIAquick PCR Purification Kit and send in for Sanger sequencing with primer pX330_seqfw (GAGGGCCTATTTCCCATGAT). Check the cloned sgRNAs for diversity and move on to the electroporation of the assembly mix into Endura cells.
Electroporation of Assembly Mix in Endura Cells
Add 2 uL of assembly mix to 25uL of Lucigen Endura electrocompetent cells, repeat 4x
Electroporate using the following parameters:
- 1mm cuvette
- 10 μF
- 600 Ohms
- 1800 Volts
Immediately add 1mL recovery media from Lucigen into the electroporation cuvette.
Gently pipet bacterial suspension into a 14 ml culture tube that already contains 1 ml of Lucigen recovery media
Incubate at 30°C for 1 hour while shaking.
In a 50 ml centrifugation tube, pool all 4 electroporation mixes together and mix well by swirling.
Take out 10 µl of the pooled electroporation mix and add to 1 ml of recovery medium. Plate out 20 and 100 µl of that dilution onto pre-warmed plates (40,000 and 8,000-fold dilution, respectively). Incubate at 30°C overnight and count colonies to determine the coverage (see step 7.5 for calculation).
Transfer the pooled electroporation mix into 400 ml LB medium supplied with 100 µg/ml ampicillin. Incubate at 30°C overnight while shaking.
Centrifuge bacterial suspension as 2x200 ml aliquotes. Maxi prep on one bacteria pellet and keep the other one as backup at -20°C.
Lentivirus Production
Lentivirus Production
Production and Titration of Lentivirus
Day -1: Plate HEK293 cells for Transfection
Plate 4x15 cm plates with HEK293FT cells at 1.625*10^7 cells per 15-cm plate in 20 mL DMEM + 10% FBS each
Day 0: Transfection of Lentiviral Plasmid Library
Prepare 2 separate tubes with the following components (mix for 1x15 cm dish transfection).
Tube A
| A | B | |
| OptiMEM | 4 ml | |
| pMDLg/pRRE | 9.7 µg | |
| pRSV-Rev | 6.5 µg | |
| pcDNA3-VSV-G | 3.3 µg | |
| Lentiviral Plasmid Library | 13 µg |
Tube B
| A | B | |
| OptiMEM | 4 ml | |
| TransIT-Lenti Transfection Reagent | 98 µl |
Combine tube A and B and mix by gently inverting. Incubate for 15 minutes at room temperature.
Gently add transfection mix dropwise to the cells.
Day 1: First Harvest
Collect lentiviral supernatant and store at 4°C. Replace medium with 16 ml of DMEM+10% FBS.
Day 2: Second Harvest
Collect lentiviral supernatant and store at 4°C. Replace medium with 16 ml of DMEM+10% FBS.
Day 3: Final Harvest and Lentivirus Concetration
Collect lentiviral supernatant and pool all lentivirus harvest together.
Centrifuge pooled lentiviral supernatant at 300xg for 5 minutes. Filter supernatant through a 0.45 µm filter and add 1/3 volume of Lenti-X Concentrator. Mix gently by inversion and incubate for 30 minutes or overnight at 4°C.
Centrifuge at 1,500xg for 45 minutes at 4°C.
Gently pour out the supernatant and resuspend pellet in 2 ml of DMEM+10% FBS per 15 cm. Aliquote 500 µl per cryotube and store at -80°C.
Titration of Lentivirus
Titrate the lentivirus on a 24 well plate using 8*10^4/well (4*10^4/cm2). Eventual experiment will use 6.25M (6.25*10^6) cells on a 15-cm (4*10^4/cm2). Each 24-well of titration uses ~1/75 as many cells as
the 15-cm plate will.
Below is the standard lentivirus titration dose chart, although you can alter if necessary. Volumes are calculated for 4 mL total lenti and should be adjusted as necessary to account for fraction of lenti produced:
‱ 1/150 = 26.66 uL
‱ 1/300 = 13.33 uL
‱ 1/600 = 6.66 uL
‱ 1/1200 = 3.33 uL
‱ 1/1800 = 2.22 uL
‱ 1/2400 = 1.67 uL
‱ 1/4800 = 0.83 uL
Day 0: Plating and Infection of HepG2 Cells
Plate 80,000 HepG2 cells per well in a 24-well supplied with polybrene in a final concentration of 8 µg/ml. Add lentivirus in the dilution steps as stated above. Have two extra wells seeded with no virus as selection control.
Day 2: Start of Puromycin Selection
Replace medium with DMEM+10% FBS supplied with 500 ng/ml puromycin
Day 3: First Passage
Wash cells with PBS and add 75 µl of trypsin. Incubate for 5 minutes at 37°C and add 500 µl of medium supplied with puromycin. Mix detached cells with a P1000 and transfer cell suspension to a new 24-well.
Day 5: Second Passage
Wash cells with PBS and add 75 µl of trypsin. Incubate for 5 minutes at 37°C and add 500 µl of medium supplied with puromycin. Mix detached cells with a P1000 and transfer cell suspension to a new 24-well.
Day 7: Count
By now, control well with no virus should be completely dead. Count each well and detemine the lentiviral dose with the highest survival. The lentiviral dose with 50% survival from that is then the desired lentiviral dosage for the screen. Multiply the dosage with 75 to scale the lentiviral dosage to the 15 cm dish format.
Lentivirus Library Infection and LDL
Day 0: Infection of HepG2 Cells
Trypsinze and count HepG2 cells. Add 6.25x106 cells to a 15 ml centrifugation tube, add lentivirus library and mix by gently inverting. Plate mix onto 15 cm dish with a total medium volume of 20 ml supplied with 8 µg/ml polybrene. Repeat this for a total number of 4 replicates.
Seed 410.000 HepG2 cells in a 6-well as selection control.
Day 1: VPA Treatment
Replace media with DMEM+10% FBS and 2mM VPA
Day 3: Start of Puromycin Selection
Replace medium with 20 ml of DMEM+10% FBS supplied with 500 ng/ml puromycin.
Day 4: First Passage
Split cells 1:2 to one new 15 cm dish with 20 ml of DMEM+10% FBS supplied with 500 ng/ml puromycin (ending up with one plate per replicate).
Day 6: Second Passage
Split cells 1:2 to two new 15 cm dish with 20 ml of DMEM+10% FBS supplied with 500 ng/ml puromycin (ending up with two plates per replicate). By now, control 6-well with no virus should be dead.
Day 8: Seed for LDL Uptake Screen
Seed 31.25x106 cells per replicate in a 15 cm dish. For bulk, seed 12,25x106 cells in a 10 cm dish. Seed both in DMEM+10% FBS.
Day 9: Serum Depravation
In the late afternoon, change medium to OptiMEM to start the serum depravation.
Day 10: LDL Uptake Screen
- 4-6 hours prior to the FACS sort, replace medium of each replicate plate with 16 ml of OptiMEM supplied 40 µl with Low Density Lipoprotein from Human Plasma, BODIPY‱ FL complex (BODIPY‱ FL LDL).
- Harvest one plate at the time - trypsinze and spin down to collect cell pellet, resuspend in DMEM+10% FBS supplied with DAPI
- Sort cells based on BODIPY signal in the following bins: Bottom 20%, Bottom 20-40%, Top 20-40%, and Top 20%.
- Isolate genomic DNA from sorted cells and bulk cells via PureLink Genomic DNA Mini Kit and elute gDNA in 100 µl.
Library Preparation for NGS
Library Preparation for NGS
Determination of CT Values for Pooling in PCR1
Perform qPCR1 to determine CT values of each sample. These values will be used to pool samples prior to PCR1 purification. Use the following primers:
101317_U6PE1_BcX(ACTCTTTCCCTACACGACGCTCTTCCGATCT NNNNN GGAAAGGACGAAACACCG)
030322_P7_anchor (CAAG CAGAAGACGGCATACGAGATCT)
qPCR for one reaction:
| A | B | |
| gDNA | 0.5 µl | |
| 2x Q5 Ultra II Master Mix | 7.5 µl | |
| 101317_U6PE1_BcX @20 µM | 0.375 µl | |
| 030322_P7_anchor @20 µM | 0.375 µl | |
| 20x EvaGreen | 0.75 µl | |
| dH20 | 5.5 |
qPCR1 program
| A | B | C | D | E | F | |
| 98°C | 98°C | 65°C | 72 °C | 72 °C | 4 °C | |
| 30 sec | 15 sec | 30 sec | 60 sec | 5 min | remaining |
Repeat steps B-D for 30x
After collecting CT values for each sample, organize samples into pools such that samples in each pool have CT values within 0.5 cycles of each other. This step is done to minimize the complexity and time of PCR1 purification and further steps of NGS preparation (qPCR2, PCR2). Note that bulk gDNA samples should never be pooled with sorted samples, regardless of CT similarity. Also note that every
sample you wish to pool after PCR1 MUST use a distinct U6PE1 barcoded primer.
PCR1 for cell-integrated libraries
Choose a distinct U6PE1 barcoded primer for each sample to the extent possible (we have 24 distinct primers). This helps to minimize monotemplate because the barcoded primers are staggered, and it allows
demultiplexing of each sample with a distinct U6PE1 during NGS analysis. You may also pool samples during PCR1 purification if they have distinct U6PE1s and qPCR1 showed Ct <0.5 cycles apart.
| A | B | |
| gDNA | 20 µg | |
| 2x Q5 Ultra II Master Mix | 400 µl | |
| 101317_U6PE1_BcX @20 µM | 20 µl | |
| 030322_P7_anchor @20 µM | 20 µl | |
| dH20 | ad 800 µl |
Cycling (30 cycles):
| A | B | C | D | E | F | |
| 98 °C | 98 °C | 65 °C | 72 °C | 72 °C | 4 °C | |
| 30 sec | 10 sec | 30 sec | 60 sec | 5 min | remaining |
You may combine samples with similar CTs (typically within 0.5 cycles, pool bulk samples separately from sorted samples) provided that they used distinct U6PE1 primers in PCR1. Add 5x volume of buffer PB and proceed to PCR purify via Qiagen PCR purification kit each pool using 1 column per pool, eluting in 100 uL EB per pool. Note that you may want to use tube extenders since there can be a lot of volume to go through one column.
Determination of CT Values for Optimal Cycle Number in PCR2
| A | B | |
| PCR1 pool | 0.5 µl | |
| 2x Q5 Ultra II Master Mix | 7.5 µl | |
| NEBNext_i5 @20 µM | 0.375 µl | |
| 030322_P7_anchor @20 µM | 0.375 µl | |
| 20x EvaGreen | 0.75 µl | |
| dH20 | 5.5 |
| A | B | C | D | E | F | |
| 98 °C | 98 °C | 65 °C | 72 °C | 72 °C | 4 °C | |
| 30 sec | 10 sec | 30 sec | 60 sec | 5 min | remaining |
Repeat step B-D for 20x
Use 2-3 cycles less than the qPCR Ct for PCR2 (it’s OK to use up to 3 cycles less than qPCR Ct and up to qPCR Ct so as to group samples most efficiently). Minimum number of PCR2 cycles is 5. If 2-3 below the CT value is <5, then use less PCR1 product input for PCR2 to compensate for 5 cycles. Ex: if your CT is 5, then 2 cycles below the CT would be 3. In order to run the minimum of 5 cycles, add in 1/4 of the normal amount of PCR1 product (so 6ul) to compensate for the two extra PCR cycles.
PCR2
PCR 2 50 uL Reaction system:
| A | B | |
| PCR1 pool | 22.5 µl | |
| 2x Q5 Ultra II Master Mix | 25 µl | |
| NEBNext_i5 @20 µM | 1.25 µl | |
| 030322_P7_anchor @20 µM | 1.25 µl |
| A | B | C | D | E | F | |
| 98 °C | 98 °C | 65 °C | 72 °C | 72 °C | 4 °C | |
| 30 sec | 10 sec | 30 sec | 60 sec | 5 min | remaining |
Repeat step B-D for the determined optimal cycles.
Amplified Library sequence: ~295-300bp
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTNNNNN ggaaaggacgaaacaccgNNNNNNNNNNNNNNNNNNNNGTTTAAGAGCTATGCTGGAAACAGCATAGCAAGTTTAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNAGATCTCGTATGCCGTCTTCTGCTTG
PCR purify PCR2 onto 1 column each. Elute in 50 µl of EB buffer.
Tapestation
Use D1000 tapescreen only, make sure to use D1000 ladder and buffer. In pcr tubes: Add 3 uL of buffer + either 1 uL of ladder or sample
Pooling sampling based on nM from Tapestation into a single tube
Pooling Calculation:
[(desired read per sample)/(desired total read across all samples)]/Tapestation nM*X000(Random number to get a reasonably pipettable amount)
SPRI bead Purification: to remove any undesirable bands (eg primer dimers) observed
on gel. Make a pool of sample, mix well, take ½ for SPRI bead purification. Add dH2O or EB up
to 50 uL. Perform 0.85X bead purification (add 42.5uL beads to pool) because product is ~300 bp. If
there is competing primer dimer close to your expected band (so between 200-250bp), you may want to be more aggressive and use 0.8X SPRI. Elute from beads with 20 µl EB buffer.